Top » Catalog » J2 » Y18548

$18.00

Y18548
[Y18548]

Y18548
hg38 Position: ChrY:13871426..13871426
Ancestral: T
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: J2a1a1b1a1c1b1
Comments: Z30677
Forward Primer: Y18548_F CATCTTCTTGTCTGTAATGTAACAATGG
Reverse Primer: Y18548_R TACACTAACCTATCAGCCAGTGCAGCTGAGC
Reviews

Customers who bought this product also purchased
Z30684
Z30684
Z30696
Z30696
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y12378
1 x FGC35418
1 x Y14435
1 x A19099
1 x HU226
1 x Y7706
1 x CTS8204
1 x SK1354
1 x FGC45075
1 x FGC80314
1 x FGC32605
1 x FGC22233
1 x Y972
1 x Y12105
1 x Y961
1 x FGC5939
1 x FGC22276
1 x FGC16627
1 x FGC45777
$342.00
Haplogroup Info
Other products
Currencies