Top » Catalog » J2 » Y14406

$18.00

Y14406
[Y14406]

Y14406
hg38 Position: ChrY:12551386..12551386
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: Aka FGC30649
Forward Primer: Y14406_F GGACCACTATGTTGCACAGG
Reverse Primer: Y14406_R ATTAGAGGCGTGCTCCACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PF5132
1 x PF5351
1 x A16352
1 x ALK669
1 x CTS10662
1 x A17950
1 x PF5413
1 x S25258
1 x FGC29946
1 x Y13671
1 x FGC34168
1 x A17943
1 x Y9399
1 x PAGES00028
1 x Y949
1 x PF7308
$288.00
Haplogroup Info
Other products
Currencies