Top » Catalog » J2 » Y14406

$18.00

Y14406
[Y14406]

Y14406
hg38 Position: ChrY:12551386..12551386
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: Aka FGC30649
Forward Primer: Y14406_F GGACCACTATGTTGCACAGG
Reverse Primer: Y14406_R ATTAGAGGCGTGCTCCACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies