Top » Catalog » J2 » Y20321

$18.00

Y20321
[Y20321]

Y20321
hg38 Position: ChrY:16809388..16809388
Ancestral: T
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J2a
Comments: Below Y20307
Forward Primer: Y20321_F CCACATTTAATCCAATATCCACAG
Reverse Primer: Y20321_R CGACTTAGGACGTGACTCCTG
Reviews

Customers who bought this product also purchased
Y20567
Y20567
J2a-Y20306 Segregation Panel
J2a-Y20306 Segregation Panel
Y20554
Y20554
Y20325
Y20325
FGC45340
FGC45340
Y20319
Y20319
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A15073
1 x A12472
1 x Y12600
1 x Y15202
1 x PH890
1 x CTS7683
1 x Y16930
1 x HU214
1 x A16337
1 x HU224
$180.00
Haplogroup Info
Other products
Currencies