Top » Catalog » J2 » Y20321

$18.00

Y20321
[Y20321]

Y20321
hg38 Position: ChrY:16809388..16809388
Ancestral: T
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J2a
Comments: Below Y20307
Forward Primer: Y20321_F CCACATTTAATCCAATATCCACAG
Reverse Primer: Y20321_R CGACTTAGGACGTGACTCCTG
Reviews

Customers who bought this product also purchased
Y20319
Y20319
Y20575
Y20575
Y20316
Y20316
Y20573
Y20573
Y20306
Y20306
Y20567
Y20567
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies