Top » Catalog » J2 » Y30092

$18.00

Y30092
[Y30092]

Y30092
hg38 Position: ChrY:13410576..13410576
Ancestral: T
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: J2a1b (unlisted)
Comments: Below Y7801
Forward Primer: Y30092_F CAAACCTTATTATTTTCTCCAGAAGC
Reverse Primer: Y30092_R GATGGTGAAGGTTTTGATTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies