Top » Catalog » J2 » Y7292

$18.00

Y7292
[Y7292]

Y7292
hg38 Position: ChrY:16597946..16597946
Ancestral: G
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: J2a1b (unlisted)
Comments: Below Y7801
Forward Primer: Y7292_F GGCTATCGCAGAATTCACAC
Reverse Primer: Y7292_R ATTTTGGGCAGGCACGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y22040
1 x FGC20423
1 x Y7008
1 x Y15174
1 x SK1321
1 x L70
1 x Y25798
1 x Y24698
1 x FGC32603
1 x A25164
1 x PF5048
$198.00
Haplogroup Info
Other products
Currencies