Top » Catalog » J2 » Y7292

$18.00

Y7292
[Y7292]

Y7292
hg38 Position: ChrY:16597946..16597946
Ancestral: G
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: J2a1b (unlisted)
Comments: Below Y7801
Forward Primer: Y7292_F GGCTATCGCAGAATTCACAC
Reverse Primer: Y7292_R ATTTTGGGCAGGCACGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies