Top » Catalog » J2 » FGC45021

$18.00

FGC45021
[FGC45021]

FGC45021
hg38 Position: ChrY:15308347..15308347
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J2a1b (unlisted)
Comments: Aka Y20512; below Z30695
Forward Primer: FGC45021_F TCATTTGGTAAATGTGTCAGTTTC
Reverse Primer: FGC45021_R GTGCCACATGCCTGAGC
Reviews

Customers who bought this product also purchased
M92
M92
Z30685
Z30685
M67
M67
Y11202
Y11202
J2a-M67 Panel
J2a-M67 Panel
Y3629
Y3629
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies