Top » Catalog » J2 » FGC45021

$18.00

FGC45021
[FGC45021]

FGC45021
hg38 Position: ChrY:15308347..15308347
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J2a1b (unlisted)
Comments: Aka Y20512; below Z30695
Forward Primer: FGC45021_F TCATTTGGTAAATGTGTCAGTTTC
Reverse Primer: FGC45021_R GTGCCACATGCCTGAGC
Reviews

Customers who bought this product also purchased
CTS900
CTS900
Y32688
Y32688
Z467
Z467
Y30809
Y30809
M92
M92
Z30685
Z30685
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16923
1 x FGC16561
1 x FGC30649
1 x J2a-PF5197 Panel
1 x PF5174
1 x FGC35495
1 x Y16934
1 x FGC36482
1 x PF5350
1 x FGC6748
1 x Y9005
1 x Y22037
1 x Y3620
1 x FGC5956
1 x L531
1 x J2-Y12007 Autrata Panel
1 x FGC21080
1 x Y14678
1 x FGC32617
1 x FGC53046
1 x L198
$736.00
Haplogroup Info
Other products
Currencies