Top » Catalog » J2 » FGC6737

$18.00

FGC6737
[FGC6737]

FGC6737
hg38 Position: ChrY:8693057..8693057
Ancestral: C
Derived: T
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream from J2-PF5456
Forward Primer: FGC6737_F CCCATTTGGATCAAGGAATG
Reverse Primer: FGC6737_R CAGCCCAGAGAGAGATACCG
Reviews

Customers who bought this product also purchased
A702
A702
FGC6743
FGC6743
FGC6751
FGC6751
FGC6742
FGC6742
FGC6750
FGC6750
FGC6759
FGC6759
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies