Top » Catalog » J2 » FGC6741

$18.00

FGC6741
[FGC6741]

FGC6741
hg38 Position: ChrY:13092667..13092667
Ancestral: T
Derived: C
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream from J2-PF5456
Forward Primer: FGC6741_F ACCTCAGAACCTCTGCCAAG
Reverse Primer: FGC6741_R TTCCCAAATGTCTGAGGACAC
Reviews

Customers who bought this product also purchased
FGC6751
FGC6751
FGC6742
FGC6742
FGC6750
FGC6750
FGC6759
FGC6759
FGC6737
FGC6737
FGC6748
FGC6748
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies