Top » Catalog » J2 » FGC6742

$18.00

FGC6742
[FGC6742]

FGC6742
hg38 Position: ChrY:13203227..13203227
Ancestral: A
Derived: G
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream from J2-PF5456
Forward Primer: FGC6742v2_F TTATACAAAGGCTGACTACCAGGAG
Reverse Primer: FGC6742v2_R CCTCCCTAGTATTTGGGATTAAAAG
Reviews

Customers who bought this product also purchased
FGC6743
FGC6743
FGC6751
FGC6751
FGC6741
FGC6741
FGC6750
FGC6750
FGC6759
FGC6759
FGC6737
FGC6737
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y22040
1 x FGC20423
1 x Y7008
1 x Y15174
1 x SK1321
1 x L70
1 x Y25798
1 x Y24698
1 x FGC32603
1 x A25164
1 x PF5048
1 x Y14314
$216.00
Haplogroup Info
Other products
Currencies