Top » Catalog » J2 » FGC6742

$18.00

FGC6742
[FGC6742]

FGC6742
hg38 Position: ChrY:13203227..13203227
Ancestral: A
Derived: G
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream from J2-PF5456
Forward Primer: FGC6742v2_F TTATACAAAGGCTGACTACCAGGAG
Reverse Primer: FGC6742v2_R CCTCCCTAGTATTTGGGATTAAAAG
Reviews

Customers who bought this product also purchased
FGC6756
FGC6756
FGC6734
FGC6734
FGC6746
FGC6746
FGC6752
FGC6752
A702
A702
FGC6743
FGC6743
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies