Top » Catalog » J2 » FGC6750

$18.00

FGC6750
[FGC6750]

FGC6750
hg38 Position: ChrY:19330376..19330376
Ancestral: A
Derived: G
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream from J2-PF5456
Forward Primer: FGC6750_F TGTACAGGTGGAAAACGCTTC
Reverse Primer: FGC6750_R CCAATGAAGTGGGTGTATTGC
Reviews

Customers who bought this product also purchased
FGC6741
FGC6741
FGC6748
FGC6748
FGC6759
FGC6759
FGC6737
FGC6737
FGC6747
FGC6747
FGC6758
FGC6758
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y22040
1 x FGC20423
1 x Y7008
1 x Y15174
1 x SK1321
1 x L70
1 x Y25798
1 x Y24698
1 x FGC32603
1 x A25164
1 x PF5048
1 x Y14314
1 x A15502
1 x FGC6742
1 x A19087
1 x AMM450
1 x Y22056
1 x Y16946
1 x Y18402
1 x PH294
$360.00
Haplogroup Info
Other products
Currencies