Top » Catalog » J2 » FGC6752

$18.00

FGC6752
[FGC6752]

FGC6752
hg38 Position: ChrY:19707042..19707042
Ancestral: C
Derived: A
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream from J2-PF5456
Forward Primer: FGC6752_F TCCTCCCACAACTCCAAAAC
Reverse Primer: FGC6752_R GAGGCCCTTCAGTGTCTCAC
Reviews

Customers who bought this product also purchased
FGC6735
FGC6735
FGC6746
FGC6746
FGC6756
FGC6756
FGC6734
FGC6734
FGC6743
FGC6743
FGC6751
FGC6751
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A16366
$18.00
Haplogroup Info
Other products
Currencies