Top » Catalog » J2 » Y22055

$18.00

Y22055
[Y22055]

Y22055
hg38 Position: ChrY:15964243..15964243
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: J2a1b (unlisted)
Comments: Below Y13654
Forward Primer: Y22055_F ACATGGAGTCCAGCCATATC
Reverse Primer: Y22055_R CCACCCATAATCATCCAATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies