Top » Catalog » J2 » Y22055

$18.00

Y22055
[Y22055]

Y22055
hg38 Position: ChrY:15964243..15964243
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: J2a1b (unlisted)
Comments: Below Y13654
Forward Primer: Y22055_F ACATGGAGTCCAGCCATATC
Reverse Primer: Y22055_R CCACCCATAATCATCCAATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC32592
1 x FGC45440
1 x CTS11100
1 x Y13675
1 x A24021
1 x L227
1 x HU198
1 x PF5183
1 x Y11291
1 x BY45500
1 x BY140494
1 x A25167
1 x Y16576
1 x FGC45321
1 x Y978
1 x Y17249
1 x L24
$306.00
Haplogroup Info
Other products
Currencies