Top » Catalog » J2 » A15071

$18.00

A15071
[A15071]

A15071
hg38 Position: ChrY:7879941..7879941
Ancestral: G
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Downstream Y26712
Forward Primer: A15071_F ATGTGAGGTGGTGACAGTCC
Reverse Primer: A15071_R CAAGGGGTGTTGTCCCATAC
Reviews

Customers who bought this product also purchased
Z8425
Z8425
Z1043
Z1043
Y105578
Y105578
Z1295
Z1295
PH1656
PH1656
Z1297
Z1297
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies