Top » Catalog » J2 » A15071

$18.00

A15071
[A15071]

A15071
hg38 Position: ChrY:7879941..7879941
Ancestral: G
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Downstream Y26712
Forward Primer: A15071_F ATGTGAGGTGGTGACAGTCC
Reverse Primer: A15071_R CAAGGGGTGTTGTCCCATAC
Reviews

Customers who bought this product also purchased
Z1297
Z1297
Y30090
Y30090
Z638
Z638
Y26712
Y26712
J2b-M12 Panel
J2b-M12 Panel
Z8425
Z8425
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30635
1 x FGC52332
1 x FGC35005
1 x HU203
1 x FGC9962
1 x Y14313
1 x SK1361
1 x L27
1 x M137
$162.00
Haplogroup Info
Other products
Currencies