Top » Catalog » J2 » A15072

$18.00

A15072
[A15072]

A15072
hg38 Position: ChrY:8609830..8609830
Ancestral: C
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Downstream Y26712
Forward Primer: A15072_F AAAACACAGCTCCACCTTGG
Reverse Primer: A15072_R ATCAGGAAAAAGGCTGCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC6752
1 x Y24651
1 x Y17051
1 x S18579
1 x A15072
1 x S396
1 x MF10560
$126.00
Haplogroup Info
Other products
Currencies