Top » Catalog » J2 » A15073

$18.00

A15073
[A15073]

A15073
hg38 Position: ChrY:14794164..14794164
Ancestral: T
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Downstream Y26712
Forward Primer: A15073_F CAGCTGGATTTGACCTAAAATTACTC
Reverse Primer: A15073_R AATAACCATAGGGTGTGGTTTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12499
1 x A13164
1 x A12450
1 x FGC17733
1 x L210
1 x FGC30508
1 x Y9011
1 x Y23722
1 x FGC52116
1 x M67
1 x Y23095
1 x Y8497
1 x Y13647
1 x Y15238
1 x SK1342
1 x Y7708
$288.00
Haplogroup Info
Other products
Currencies