Top » Catalog » J2 » Y21525

$18.00

Y21525
[Y21525]

Y21525
hg38 Position: ChrY:9248251..9248251
Ancestral: C
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J2b2a1a1 (not listed)
Comments: Below Y12005
Forward Primer: Y21525_F GTCATTGACACAGAACTTGACAGG
Reverse Primer: Y21525_R CTTGCTGGTCCACTTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies