Top » Catalog » J2 » Y21525

$18.00

Y21525
[Y21525]

Y21525
hg38 Position: ChrY:9248251..9248251
Ancestral: C
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J2b2a1a1 (not listed)
Comments: Below Y12005
Forward Primer: Y21525_F GTCATTGACACAGAACTTGACAGG
Reverse Primer: Y21525_R CTTGCTGGTCCACTTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y14434
1 x Y17408
1 x FGC30343
1 x PF5380
1 x FGC6738
1 x Y15169
1 x PF4275
1 x Y12622
1 x BY24003
1 x PF5294
1 x A19079
1 x FGC20254
1 x Y12594
1 x FGC32591
1 x M12
1 x A12503
1 x BY21723
1 x Y14701
1 x FGC9878
$342.00
Haplogroup Info
Other products
Currencies