Top » Catalog » J2 » Y21878

$18.00

Y21878
[Y21878]

Y21878
hg38 Position: ChrY:9247407..9247407
Ancestral: C
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J2b2a1a (not listed
Comments: Below Z1297>Z1295 peer to Z631
Forward Primer: Y21878_F GATCTGCAAATGCAGTGACTTG
Reverse Primer: Y21878_R ACCCATCCTCTGCCATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies