Top » Catalog » J2 » Y21878

$18.00

Y21878
[Y21878]

Y21878
hg38 Position: ChrY:9247407..9247407
Ancestral: C
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J2b2a1a (not listed
Comments: Below Z1297>Z1295 peer to Z631
Forward Primer: Y21878_F GATCTGCAAATGCAGTGACTTG
Reverse Primer: Y21878_R ACCCATCCTCTGCCATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FT69031
1 x Y16821
1 x Y4036
1 x FGC32615
1 x Y15245
1 x CTS6521
1 x Y12605
1 x Y966
1 x Y13534
1 x Y14715
1 x Y14594
1 x PH3081
1 x J2a-L271 Segregation Panel
1 x BY132829
1 x Y12005
1 x FGC6726
1 x Y3612
1 x Y14699
1 x Y12937
1 x Y12601
$523.00
Haplogroup Info
Other products
Currencies