Top » Catalog » J2 » Y24698

$18.00

Y24698
[Y24698]

Y24698
hg38 Position: ChrY:13127584..13127584
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: J2b2 (not listed)
Comments: Below L283>Z590>Z2505>YP113>YP82
Forward Primer: Y24698_F GTTAGGGGAAAACCGCCTAC
Reverse Primer: Y24698_R AGGGGAGGGTTCAAGTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies