Top » Catalog » J2 » Y24698

$18.00

Y24698
[Y24698]

Y24698
hg38 Position: ChrY:13127584..13127584
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: J2b2 (not listed)
Comments: Below L283>Z590>Z2505>YP113>YP82
Forward Primer: Y24698_F GTTAGGGGAAAACCGCCTAC
Reverse Primer: Y24698_R AGGGGAGGGTTCAAGTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19092
1 x Y16947
1 x SK1368
1 x A22313
1 x A24018
1 x S399
1 x Y16955
1 x Y16904
1 x Y12371
1 x PF4941
1 x FGC22278
1 x HU197
$216.00
Haplogroup Info
Other products
Currencies