Top » Catalog » J2 » FGC29945

$18.00

FGC29945
[FGC29945]

FGC29945
hg38 Position: ChrY:12204533..12204533
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2a1h (not listed)
Comments: Below Z7700 > L363 > FGC9966 > FGC29946 > FGC29947
Forward Primer: FGC29945_F AGGCACACGCTACCACACC
Reverse Primer: FGC29945_R CCATGCCTGGATAAAATTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4712
1 x Y18130
1 x FGC14706
1 x Y15275
1 x BY22058
1 x A23320
1 x SK1398
1 x BY20079
1 x Y10757
1 x Y11202
1 x Y56433
1 x SK1392
1 x Y14148
1 x A13335
1 x SK1356
1 x A22571
1 x FGC4423
$306.00
Haplogroup Info
Other products
Currencies