Top » Catalog » J2 » FGC29945

$18.00

FGC29945
[FGC29945]

FGC29945
hg38 Position: ChrY:12204533..12204533
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2a1h (not listed)
Comments: Below Z7700 > L363 > FGC9966 > FGC29946 > FGC29947
Forward Primer: FGC29945_F AGGCACACGCTACCACACC
Reverse Primer: FGC29945_R CCATGCCTGGATAAAATTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y17054
1 x Y9405
1 x A24024
1 x Y2163
1 x FGC19515
1 x FGC32611
$108.00
Haplogroup Info
Other products
Currencies