Top » Catalog » J2 » FGC29947

$18.00

FGC29947
[FGC29947]

FGC29947
hg38 Position: ChrY:15921904..15921904
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2a1h (not listed)
Comments: Below Z7700 > L363 > FGC9966 > FGC29946
Forward Primer: FGC29947_F ACCCAATGACACAGTGAAACC
Reverse Primer: FGC29947_R GTTTTTCTCCTGCCCTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies