Top » Catalog » J2 » FGC29949

$18.00

FGC29949
[FGC29949]

FGC29949
hg38 Position: ChrY:11985154..11985154
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2a1h (not listed)
Comments: Below Z7700 > L363 > A5834 > FGC16628
Forward Primer: FGC29949_F TCTGACTCTTGCCCAAAACTG
Reverse Primer: FGC29949_R CTCTACCATGGCGTTATGTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FT69031
1 x Y16821
1 x Y4036
1 x FGC32615
1 x Y15245
1 x CTS6521
1 x Y12605
1 x Y966
1 x Y13534
1 x Y14715
1 x Y14594
1 x PH3081
1 x J2a-L271 Segregation Panel
1 x BY132829
1 x Y12005
1 x FGC6726
1 x Y3612
$469.00
Haplogroup Info
Other products
Currencies