Top » Catalog » J2 » FGC29950

$18.00

FGC29950
[FGC29950]

FGC29950
hg38 Position: ChrY:16716405..16716405
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2a1h (not listed)
Comments: Below Z7700 > L363 > A5834 > FGC16628
Forward Primer: FGC29950_F CATAACCACGTGTCTCCAAGAAG
Reverse Primer: FGC29950_R CACAAGGAATCCACACTTAAACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y17029
$18.00
Haplogroup Info
Other products
Currencies