Top » Catalog » J2 » FGC29951

$18.00

FGC29951
[FGC29951]

FGC29951
hg38 Position: ChrY:16772514..16772514
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2a1h (not listed)
Comments: Below Z7700 > L363 > A5834 > FGC16628 > FGC29950
Forward Primer: FGC29951_F CTCGGGCATCTTAGACATCC
Reverse Primer: FGC29951_R GCAGTTTCTTCAGTTCTTTCTGTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC20437
1 x A11793
1 x CTS1225
1 x PF5196
1 x A5360
1 x Y14375
1 x FGC61398
$126.00
Haplogroup Info
Other products
Currencies