Top » Catalog » J2 » FGC35461

$18.00

FGC35461
[FGC35461]

FGC35461
hg38 Position: ChrY:4245778..4245778
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2a1h2 (not listed)
Comments: Below FGC35472
Forward Primer: FGC35461_F TCCTTTGGCAAGGAAATAAATG
Reverse Primer: FGC35461_R AGACGTAGAAAGCGAGAGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies