Top » Catalog » J2 » FGC35461

$18.00

FGC35461
[FGC35461]

FGC35461
hg38 Position: ChrY:4245778..4245778
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2a1h2 (not listed)
Comments: Below FGC35472
Forward Primer: FGC35461_F TCCTTTGGCAAGGAAATAAATG
Reverse Primer: FGC35461_R AGACGTAGAAAGCGAGAGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16923
1 x FGC16561
1 x FGC30649
1 x J2a-PF5197 Panel
1 x PF5174
1 x FGC35495
1 x Y16934
1 x FGC36482
1 x PF5350
1 x FGC6748
$250.00
Haplogroup Info
Other products
Currencies