Top » Catalog » J2 » PF5243

$18.00

PF5243
[PF5243]

PF5243
hg38 Position: ChrY:14126271..14126271
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1 (unlisted)
Comments: Extracted from genome study of Sardinian samples; below PF5183
Forward Primer: PF5243_F GAGCAGGAGATAAGAATTTGAGG
Reverse Primer: PF5243_R TGTTTGAGATGTTGTGGTAGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC6746
1 x A1218
$36.00
Haplogroup Info
Other products
Currencies