Top » Catalog » J2 » PF5243

$18.00

PF5243
[PF5243]

PF5243
hg38 Position: ChrY:14126271..14126271
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1 (unlisted)
Comments: Extracted from genome study of Sardinian samples; below PF5183
Forward Primer: PF5243_F GAGCAGGAGATAAGAATTTGAGG
Reverse Primer: PF5243_R TGTTTGAGATGTTGTGGTAGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16823
1 x Y3636
1 x L229
1 x Y12604
1 x B437
1 x SK1324
1 x A24015
1 x FGC20157
1 x BY32798
1 x FGC61400
1 x Y22076
1 x A25165
1 x Y13097
1 x A17063
1 x A16358
1 x PAGES00014
1 x Y25793
1 x FGC9961
1 x Y9404
1 x A19129
$360.00
Haplogroup Info
Other products
Currencies