Top » Catalog » J2 » Y24651

$18.00

Y24651
[Y24651]

Y24651
hg38 Position: ChrY:17398287..17398287
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J2a1h2a1 (unlisted)
Comments: Aka FGC54172; below PF5456
Forward Primer: Y24651v2_F CCTTAATCTTGAACTTACAGCCTCTG
Reverse Primer: Y24651v2_R AAAAAAAGAGATCAGTTAGTTGTAGATGTG
Reviews

Customers who bought this product also purchased
A19118
A19118
FGC21087
FGC21087
A19087
A19087
FGC21081
FGC21081
FGC21094
FGC21094
A18941
A18941
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies