Top » Catalog » J2 » Y24651

$18.00

Y24651
[Y24651]

Y24651
hg38 Position: ChrY:17398287..17398287
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J2a1h2a1 (unlisted)
Comments: Aka FGC54172; below PF5456
Forward Primer: Y24651v2_F CCTTAATCTTGAACTTACAGCCTCTG
Reverse Primer: Y24651v2_R AAAAAAAGAGATCAGTTAGTTGTAGATGTG
Reviews

Customers who bought this product also purchased
FGC21094
FGC21094
A18941
A18941
FGC21080
FGC21080
FGC21092
FGC21092
J2-BY268-Kessler Panel
J2-BY268-Kessler Panel
FGC21079
FGC21079
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y15163
1 x A17940
1 x PH185
1 x Y20573
1 x Y13374
1 x A24023
1 x A24017
1 x FGC45021
1 x P244.2
1 x FGC32608
$180.00
Haplogroup Info
Other products
Currencies