Top » Catalog » J2 » FGC35418

$18.00

FGC35418
[FGC35418]

FGC35418
hg38 Position: ChrY:7985228..7985228
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2a1h (unlisted)
Comments: Below Y15169>FGC45785
Forward Primer: FGC35418_F GGTTTTCATGGAGCCTGATG
Reverse Primer: FGC35418_R CCGTTTGTTGTCAACTGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies