Top » Catalog » J2 » FGC45785

$18.00

FGC45785
[FGC45785]

FGC45785
hg38 Position: ChrY:20032344..20032345
Ancestral: ins
Derived: del
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J2a1h (unlisted)
Comments: Below F3369
Forward Primer: FGC45785_F ACCAAAAACCCATCTGTACATTG
Reverse Primer: FGC45785_R TCTTTAAGAATGTTGAATATTGGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12375
1 x FGC9883
1 x FGC6735
1 x A19158
1 x A24020
1 x A23495
1 x MF10466
1 x Y18216
1 x FT84003
1 x FGC32512
1 x FGC15901
1 x Y18548
1 x FGC50114
1 x BY183679
1 x BY183199
1 x M340
1 x FGC86496
1 x SK1401
1 x M221
1 x Y16996
$360.00
Haplogroup Info
Other products
Currencies