Top » Catalog » J2 » FGC45785

$18.00

FGC45785
[FGC45785]

FGC45785
hg38 Position: ChrY:20032344..20032345
Ancestral: ins
Derived: del
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J2a1h (unlisted)
Comments: Below F3369
Forward Primer: FGC45785_F ACCAAAAACCCATCTGTACATTG
Reverse Primer: FGC45785_R TCTTTAAGAATGTTGAATATTGGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies