Top » Catalog » J2 » PF5416

$18.00

PF5416
[PF5416]

PF5416
hg38 Position: ChrY:8146825..8146825
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1h2 (unlisted)
Comments: Extracted from genome study of Sardinian samples; below L25 & above Z421
Forward Primer: PF5416_F GCAAGTTAGAGTAAATGCCGAAAG
Reverse Primer: PF5416_R CACTTTGGGAGGCCAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies