Top » Catalog » J2 » FGC8076

$18.00

FGC8076
[FGC8076]

FGC8076
hg38 Position: ChrY:6958745..6958745
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J2a1h2 (not listed)
Comments: Below L363
Forward Primer: FGC8076_F AAGAACTGTAAAAATTCAAGAGGGAG
Reverse Primer: FGC8076_R GAGAAAAACCGCCCTATGGTA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC21088
1 x SK1326
1 x S5061
1 x A23497
1 x PH878
1 x Y16356
$108.00
Haplogroup Info
Other products
Currencies