Top » Catalog » J2 » Y20051

$18.00

Y20051
[Y20051]

Y20051
hg38 Position: ChrY:12203857..12203857
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J2a1b1 (unlisted)
Comments: Below PF7402 above L560
Forward Primer: Y20051_F GAGGCAGGAGGATGGTGTC
Reverse Primer: Y20051_R GAAGTCATGAGGCCTAGTGAAAG
Reviews

Customers who bought this product also purchased
Z6257
Z6257
M67
M67
L26
L26
J2-M172 Superclade Panel
J2-M172 Superclade Panel
Z467
Z467
Y11782
Y11782
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC6747
1 x J2a-L24 Panel
1 x A15507
1 x A17934
1 x FGC20435
1 x Y16841
1 x Y13373
1 x FGC32480
1 x A23494
1 x BY25020
1 x CTS6804
$268.00
Haplogroup Info
Other products
Currencies