Top » Catalog » J2 » Y13097

$18.00

Y13097
[Y13097]

Y13097
hg38 Position: ChrY:12655298..12655298
Ancestral: C
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: J2a1b1 (unlisted)
Comments: Aka FGC20417
Forward Primer: Y13097_F GGGTCTTGCTCTGTCACTCTG
Reverse Primer: Y13097_R GGGTCAGAGAAATGGGAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies