Top » Catalog » J2 » Y24492

$18.00

Y24492
[Y24492]

Y24492
hg38 Position: ChrY:17433591..17433591
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J2a1b3 (unlisted)
Comments: Below Z30388>Y15247
Forward Primer: Y24492_F CCTTTACCCGGAGCATTTC
Reverse Primer: Y24492_R CAAACTGCAAGCCAGGAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC32592
1 x FGC45440
1 x CTS11100
1 x Y13675
1 x A24021
$90.00
Haplogroup Info
Other products
Currencies