Top » Catalog » J2 » Y29721

$18.00

Y29721
[Y29721]

Y29721
hg38 Position: ChrY:18956224..18956224
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: J2b
Comments: .
Forward Primer: Y29721_F GATAACAAGCCTGTGGTCCAG
Reverse Primer: Y29721_R CTGATTTGCTCACAATCACATATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y48831
1 x BY25020
$36.00
Haplogroup Info
Other products
Currencies