Top » Catalog » J2 » A15501

$18.00

A15501
[A15501]

A15501
hg38 Position: ChrY:8229959..8229959
Ancestral: G
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Below Y13373
Forward Primer: A15501_F AAAACATTAAAAACAAGTCTTGAAAAATTAAG
Reverse Primer: A15501_R TGTGTTTTTTATTTTTCATTTTTCCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies