Top » Catalog » J2 » A15501

$18.00

A15501
[A15501]

A15501
hg38 Position: ChrY:8229959..8229959
Ancestral: G
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Below Y13373
Forward Primer: A15501_F AAAACATTAAAAACAAGTCTTGAAAAATTAAG
Reverse Primer: A15501_R TGTGTTTTTTATTTTTCATTTTTCCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19092
1 x Y16947
1 x SK1368
1 x A22313
1 x A24018
1 x S399
1 x Y16955
1 x Y16904
1 x Y12371
1 x PF4941
1 x FGC22278
1 x HU197
1 x FGC30368
1 x Y13620
1 x A11791
1 x HU213
1 x L254
1 x Y12588
1 x A20725
$342.00
Haplogroup Info
Other products
Currencies