Top » Catalog » J2 » A15503

$18.00

A15503
[A15503]

A15503
hg38 Position: ChrY:19146327..19146327
Ancestral: T
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Below Y13373
Forward Primer: A15503_F TGGCCAAAGAGATGGCTAAC
Reverse Primer: A15503_R ATCTGGCCCCCTTGATTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15895
1 x Y20053
1 x Y13343
1 x PF7372
1 x A12380
$90.00
Haplogroup Info
Other products
Currencies