Top » Catalog » J2 » A15507

$18.00

A15507
[A15507]

A15507
hg38 Position: ChrY:16072357..16072357
Ancestral: C
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Below Y13373
Forward Primer: A15507_F TCAAAGTCATGTTGCCCAAG
Reverse Primer: A15507_R TGAGGGAGGGAAAGGATCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12375
1 x FGC9883
1 x FGC6735
1 x A19158
1 x A24020
1 x A23495
1 x MF10466
1 x Y18216
1 x FT84003
1 x FGC32512
$180.00
Haplogroup Info
Other products
Currencies