Top » Catalog » J2 » A15508

$18.00

A15508
[A15508]

A15508
hg38 Position: ChrY:8059723..8059723
Ancestral: G
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Below Y13373
Forward Primer: A15508_F GGTGCAGTTGTGACTCTTGG
Reverse Primer: A15508_R GGACCCATTCCAGAGAGGAG
Reviews

Customers who bought this product also purchased
A15509
A15509
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19114
1 x A11525
1 x Y14698
1 x FGC6756
1 x A18941
1 x BY32788
1 x L530
1 x Y17052
1 x Y17020
1 x S11348
1 x FGC21086
1 x CTS7515
$216.00
Haplogroup Info
Other products
Currencies