Top » Catalog » J2 » A15509

$18.00

A15509
[A15509]

A15509
hg38 Position: ChrY:21851728..21851728
Ancestral: C
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Below Y13373
Forward Primer: A15509_F AACTCTCTTTCCCACAGAGAATGAG
Reverse Primer: A15509_R GCTGATAACTTTAGGAGGAGAAGC
Reviews

Customers who bought this product also purchased
A15508
A15508
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1393
1 x Y3622
1 x FGC5960
1 x Y17059
1 x SK1377
1 x P81
1 x Y17026
1 x FGC16138
$144.00
Haplogroup Info
Other products
Currencies