Top » Catalog » J2 » Y17249

$18.00

Y17249
[Y17249]

Y17249
hg38 Position: ChrY:17320413..17320413
Ancestral: T
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: J2a
Comments: Below or equiv. to L271
Forward Primer: Y17249_F GCTCCAGATTGGCCTAACTATG
Reverse Primer: Y17249_R GAGCCATAATTCCCTAGTTTTACATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies