Top » Catalog » J2 » HU166

$18.00

HU166
[HU166]

HU166
hg38 Position: ChrY:21828838..21828838
Ancestral: A
Derived: G
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2
Comments: Approx. Z33905
Forward Primer: HU166_F AGGATACAATCTGGTGAAGTTTCAG
Reverse Primer: HU166_R CCAAGAAACCCTAGGCCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY8401
1 x FGC4021
1 x SK1493
1 x FGC36669
1 x FGC35458
1 x Y40683
1 x FGC37843
1 x A261
1 x Y20925
1 x Y109939
1 x BY740
1 x BY9
1 x A6422
$234.00
Haplogroup Info
Other products
Currencies