Top » Catalog » J2 » HU167

$18.00

HU167
[HU167]

HU167
hg38 Position: ChrY:8395791..8395791
Ancestral: T
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2
Comments: Approx. Z33905
Forward Primer: HU167_F TTTTCATGGGTGACAGTTGG
Reverse Primer: HU167_R TCTGCCTGGACACTGACAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies