Top » Catalog » J2 » HU169

$18.00

HU169
[HU169]

HU169
hg38 Position: ChrY:9975176..9975176
Ancestral: T
Derived: A
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2
Comments: Approx. Z33905
Forward Primer: HU169_F AGTCACACCCAGTCCACTCC
Reverse Primer: HU169_R CCCTCATGAAGTTTCCCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies