Top » Catalog » J2 » FGC11596

$18.00

FGC11596
[FGC11596]

FGC11596
hg38 Position: ChrY:14189719..14189719
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1
Comments: Below S25338
Forward Primer: FGC11596_F GAGCAATTTTATCCCCCAGAG
Reverse Primer: FGC11596_R TATGGTTCCATAGCGAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies