Top » Catalog » J2 » FGC11596

$18.00

FGC11596
[FGC11596]

FGC11596
hg38 Position: ChrY:14189719..14189719
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1
Comments: Below S25338
Forward Primer: FGC11596_F GAGCAATTTTATCCCCCAGAG
Reverse Primer: FGC11596_R TATGGTTCCATAGCGAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19114
1 x A11525
1 x Y14698
1 x FGC6756
1 x A18941
1 x BY32788
1 x L530
1 x Y17052
1 x Y17020
1 x S11348
1 x FGC21086
1 x CTS7515
1 x FGC21092
1 x A12377
1 x Y958
1 x Y14400
$288.00
Haplogroup Info
Other products
Currencies