Top » Catalog » J2 » HU200

$18.00

HU200
[HU200]

HU200
hg38 Position: ChrY:13545537..13545537
Ancestral: T
Derived: A
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU200_F CAAAAAGAGCAAAGGTGGAG
Reverse Primer: HU200_R TCATGAAATCTTTGCCCATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies