Top » Catalog » J2 » HU201

$18.00

HU201
[HU201]

HU201
hg38 Position: ChrY:13789646..13789646
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below S25338
Forward Primer: HU201_F GAAGAGGCAAATAGATAAAGACAGAAAGTAG
Reverse Primer: HU201_R TTCCACATAACTAAGATTTTGGTCATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12499
1 x A13164
1 x A12450
1 x FGC17733
1 x L210
1 x FGC30508
1 x Y9011
1 x Y23722
$144.00
Haplogroup Info
Other products
Currencies